Environmental cadmium exposure and experimental cardiovascular toxicity: protective role of erythropoietin with public health implications
Environmental cadmium & heart damage: epo shields
Authors
Abstract
AimCadmium (Cd) is an environmental heavy metal that accumulates in cardiac tissue and contributes to the development of cardiovascular disease. Erythropoietin (EPO), traditionally recognized for its role in erythropoiesis, also exhibits potent cytoprotective properties. This study examined whether EPO can mitigate Cd induced cardiac injury and explored the molecular mechanisms involved.
MethodsAdult male rats were assigned to four groups: control, EPO alone, cadmium chloride alone, and EPO plus cadmium. Cardiac injury was evaluated through serum biomarkers, oxidative stress indices, inflammatory mediators, and markers of ferroptosis and apoptosis. Key signaling pathways were assessed using ELISA and quantitative gene expression analysis.
ResultsCadmium exposure significantly increased cardiac injury markers, elevated reactive oxygen species and lipid peroxidation, and depleted endogenous antioxidant defenses. It also activated NF κB–mediated inflammation and induced both ferroptotic and apoptotic cell death. These alterations were accompanied by marked suppression of the PI3K/AKT survival pathway. EPO co treatment substantially reduced oxidative damage, lowered inflammatory cytokines, restored antioxidant enzyme activities, and inhibited cell death pathways. Importantly, EPO reactivated PI3K/AKT signaling, which was associated with enhanced Nrf2 mediated antioxidant responses and reduced NF κB driven inflammation.
ConclusionErythropoietin effectively attenuates cadmium induced cardiotoxicity by restoring survival signaling, strengthening antioxidant defenses, suppressing inflammation, and limiting multiple forms of cell death.
Keywords
Introduction
Cadmium (Cd) is a highly toxic environmental and industrial pollutant that poses a growing global health concern. Human exposure has increased substantially due to expanding industrialization and lifestyle related sources. Cigarette smoke, occupational environments, contaminated food, and polluted water are major contributors to Cd intake, while additional contamination arises from activities such as mining, oil extraction, plastics manufacturing, battery production, welding, and soldering.1 The persistence of Cd in soil, water, and air underscores its significance as a long term public health hazard.
Among the organs affected by Cd, the heart is particularly vulnerable. Cd disrupts cardiovascular homeostasis by interfering with cytochrome P450 enzymes, disturbing redox balance, and accumulating within cardiac tissue, leading to oxidative stress, DNA damage, and transcriptional dysregulation.2 The resulting oxidative imbalance activates inflammatory signaling pathways and stimulates the release of pro inflammatory cytokines.3 Cd also disrupts sulfhydryl homeostasis, suppresses antioxidant capacity, and promotes apoptotic cell death, collectively contributing to progressive cardiac injury.4 Because oxidative stress and inflammation are central drivers of Cd induced cardiotoxicity, antioxidant based interventions have gained increasing attention as potential strategies to mitigate metal induced organ damage.
Erythropoietin (EPO), a hematopoietic cytokine whose receptors are expressed in several non hematopoietic tissues including cardiomyocytes, has emerged as a potent cytoprotective molecule.5 Experimental studies demonstrate that EPO confers cardioprotection independent of its erythropoietic function by reducing inflammatory mediators, attenuating apoptosis, and limiting oxidative damage in models of cardiac stress.6 Despite extensive research, the full mechanistic spectrum of EPO’s protective actions remains incompletely defined, reflecting its multifaceted biological activity. In the context of environmental Cd exposure and its cardiovascular consequences, the present study was designed to evaluate the cardioprotective effects of EPO and elucidate the underlying mechanisms.
Materials and Methods
AnimalsForty adult male Wistar rats weighing 210–330 g were used in this study. The animals were housed under controlled laboratory conditions, including a 12 hour light/12 hour dark cycle (lights on from 08:00 to 20:00) and an ambient temperature of 22 ± 2 °C. All rats had free access to standard chow and water throughout the experimental period.
Experimental LayoutAfter the acclimation period, the animals were randomly assigned to four experimental groups, each consisting of ten rats:
Group I (Control): Received 0.5% carboxymethyl cellulose (CMC; Sigma, USA) orally for seven consecutive days.
Group II (EPO): Administered erythropoietin (EPO) at 6000 IU/kg/day via intraperitoneal (i.p.) injection for seven days. The selected dose and route followed the hepatoprotective protocol described by Saddam et al..7
Group III (Cd): Given oral 0.5% CMC for 7 days and injected intraperitoneally with cadmium chloride (CdCl₂; Sigma, USA) at 1.2 mg/kg on day seven.
Group IV (EPO + Cd): Treated with EPO at 6000 IU/kg/day i.p. for six days, followed by a single i.p. injection of CdCl₂ (1.2 mg/kg) on day seven.
The Cd dose and administration method were selected according to previously published studies investigating cadmium induced toxicity.8
At the end of the experimental period, blood samples were collected under ketamine anesthesia. Serum was separated by centrifugation and used to determine the activities of AST, CK MB, and LDH. Following blood collection, the rats were euthanized, and the hearts were excised, rinsed, and dissected to isolate the left ventricle. Ventricular tissue was homogenized in 10% (w/v) Tris HCl buffer and centrifuged; the resulting supernatant was stored for biochemical analyses. Additional tissue samples were fixed in 10% formalin for histological evaluation or stored at –80 °C for molecular studies.
Biochemical AssaySOD activity was measured using a standard colorimetric assay based on the enzyme’s ability to inhibit the reduction of nitroblue tetrazolium. GSH levels were quantified using a conventional spectrophotometric method involving the formation of a yellow chromophore with Ellman’s reagent. Lipid peroxidation was assessed by determining MDA concentrations using the TBARS method. ROS generation was evaluated fluorometrically by measuring the oxidation of a non fluorescent probe to its fluorescent product.
Histopathological ExaminationHeart tissues fixed in 10% neutral buffered formalin were thoroughly washed, dehydrated through a graded ethanol series, cleared in xylene, and embedded in paraffin wax. The paraffin blocks were sectioned, and the resulting tissue slices were stained with H&E to be examined under a light microscope.
ELISA MeasurementsThe ELISA kits used in this study and their corresponding detection ranges were as follows: CK MB (MBS2515061, 31.25–2000 pg/mL), AST (MBS264975, 3.12–200 U/L), LDH (MBS2018912, 1.56-100 ng/mL), Nrf2 (RK13241, 78.13–5000 pg/mL), (HO 1; ab279414, 15.63–1000 pg/mL), (NF κB; ER1186, 0.156–10 ng/mL), TNF α (MBS282960, 6.25 pg/mL - 400 pg/mL), IL 6 (MBS269892, 15.6–1000 pg/mL), (IL 1β; MBS2023030, 15.6–1000 pg/mL), SLC7A11 (ABIN6959628, 1.56–100 ng/mL), (GPX4; MBS934198, 7.8–500 pg/mL), caspase 3 (MBS261814, 1.56–100 ng/mL), Bax (ER0512, 0.313–20 ng/mL), and Bcl 2 (ERBCL2L2, 0.41–100 ng/mL).
qRT-PCR AnalysisQuantitative real time PCR (qRT PCR) was performed to evaluate gene expression levels in cardiac tissue. Approximately 100 ng of ventricular tissue was homogenized in Qiazol reagent for total RNA extraction, and cDNA was synthesized using a Multi Scribe reverse transcriptase kit. qRT PCR amplification was carried out on a 7500 Real Time PCR System using SYBR Green PCR Master Mix. Relative gene expression was calculated using the 2−ΔΔCT method, with β actin serving as the internal reference gene. Expression differences were determined based on relative CT values. The primer sequences used were as follows. PI3K forward 5′ AACACAGAAGACCAATACTC 3′ and reverse 5′ TTCGCCATCTACCACTAC 3′; Akt forward 5′ GTGGCAAGATGTGTATGAG 3′ and reverse 5′ CTGGCTGAGTAGGAGAAC 3′; and β actin forward 5′ CCTGGAGAAGAGCTATGAGC 3′ and reverse 5′ ACAGGATTCCATACCCAGG 3′.
Ethical ApprovalThis study was approved by the Ethics Committee of Umm Al-Qura University, Makkah, Saudi Arabia (Date: 03.01.2026; Decision No.: HAPO-02-K-012-2026-05-3436).
Statistical AnalysisData were expressed as mean ± SD and analyzed using GraphPad Prism software (version 8.0). Differences among groups were assessed using one way ANOVA, followed by the Newman–Keuls post hoc test for multiple comparisons. A p value < 0.05 was considered statistically significant.
Reporting GuidelinesThis study was reported in accordance with the ARRIVE 2.0 guidelines.
Results
EPO Improves Cardiac Morphology and Normalizes Serum Cardiac EnzymesFigure 1A–H present the histological examination of cardiac tissues. Healthy cardiomyocytes were observed in the control group, while the cadmium (Cd) group showed marked vascular congestion and cardiac muscle vacuolations. These abnormalities were ameliorated in the combined treatment group (EPO + Cd).
Consistent with the histological preservation observed in the EPO treated group, biochemical markers of myocardial injury showed substantial improvement. Cadmium exposure caused a dramatic rise in circulating CK MB, increasing from 55.1 ± 23.2 in control rats to 395.6 ± 124.7 pg/mL (p<0.05). Similarly, AST levels escalated from 48.7 ± 4.6 to 172.8 ± 6.9 U/L (p<0.05), while LDH surged from 3.14 ± 0.73 to 81.7 ± 7.4 ng/mL (p<0.05). These elevations confirm substantial cardiomyocyte membrane damage following Cd administration.
Co treatment with EPO (6000 IU/kg) markedly reduced these enzyme elevations. CK MB declined to 117.0 ± 38.7 (p<0.05 vs. Cd), AST decreased to 98.0 ± 17.4 (p<0.05), and LDH fell to 37.4 ± 6.2 (p<0.05). Although values did not fully return to baseline, the substantial reductions indicate a strong cardioprotective effect (Fig.1 I-K).
These biochemical improvements parallel the structural preservation observed histologically, reinforcing that EPO effectively limits Cd induced myocardial injury by stabilizing cardiomyocyte membranes and reducing leakage of intracellular enzymes.
EPO Attenuates Cd Induced Cardiac Oxidative DisturbancesCadmium exposure (1.2 mg/kg, i.p.) produced a pronounced oxidative burden in cardiac tissue, as reflected by a marked rise in MDA (8.06 ± 0.92 vs. 1.04 ± 0.23 µmol/mg protein in controls, p<0.05) and elevated ROS (3.47 ± 0.29 vs. 0.48 ± 0.07, p<0.05). This oxidative escalation coincided with a sharp collapse in antioxidant defenses, where SOD declined to 1.54 ± 0.22 from 14.66 ± 0.94 U/mg (p<0.05), and CAT dropped to 7.52 ± 0.87 compared with 22.71 ± 1.01 U/mg (p<0.05).
These biochemical disruptions were paralleled by a suppression of the Nrf2/HO 1 axis, with Nrf2 reduced to 82.9 ± 3.5 vs. 229.4 ± 25.1 pg/mg (p<0.05) and HO 1 falling to 248.9 ± 68.1 vs. 897.1 ± 33.4 pg/mg (p<0.05), confirming a profound impairment of endogenous cytoprotective signaling.
Co administration of EPO (6000 IU/kg) substantially counteracted these Cd driven alterations. EPO lowered MDA to 4.66 ± 0.96 (p<0.0001 vs. Cd) and reduced ROS to 1.47 ± 0.54 (p<0.05), indicating a clear decline in lipid peroxidation and free radical accumulation. Antioxidant enzymes exhibited notable recovery, with SOD rising to 5.64 ± 0.93 and CAT increasing to 16.82 ± 1.55 (both p<0.05 vs. Cd).
Importantly, EPO reactivated Nrf2 signaling, elevating Nrf2 to 147.7 ± 13.0 and HO 1 to 524.8 ± 72.4 (both p<0.05 vs. Cd), demonstrating restoration of the transcriptional antioxidant machinery (Fig. 1A-F). These findings demonstrate that EPO mitigates Cd evoked oxidative injury by curbing ROS generation, stabilizing enzymatic defenses, and re engaging the Nrf2/HO 1 cytoprotective pathway.
Anti Inflammatory Impact of EPO on Cd Induced Cardiac InflammationCadmium administration triggered a substantial inflammatory response in cardiac tissue, as demonstrated by significant elevations in NF κB, TNF α, IL 1β, and IL 6 relative to control animals (all p<0.05). NF κB increased sharply from 1.78 ± 0.27 in controls to 8.53 ± 0.71 in the Cd group, while TNF α surged from 10.12 ± 2.33 to 235.0 ± 12.5 pg/mg. Similarly, IL 1β rose from 20.7 ± 3.5 to 143.6 ± 8.4 pg/mg, and IL 6 escalated from 196.5 ± 38.1 to 688.0 ± 92.4 pg/mg, confirming a robust pro inflammatory shift.
Co treatment with EPO (6000 IU/kg) markedly tempered this inflammatory activation. NF κB levels declined to 4.93 ± 1.06 (p<0.05 vs. Cd), while TNF α dropped to 66.2 ± 18.3 (p<0.05). IL 1β was reduced to 76.6 ± 14.1, and IL 6 decreased to 361.4 ± 43.7 (both p<0.05 vs. Cd). These reductions indicate a strong inhibitory effect of EPO on Cd driven cytokine release and transcriptional inflammatory signaling (Fig. 2G-J).
The attenuation of inflammatory mediators aligns with the previously described antioxidant restoration, suggesting that EPO not only limits oxidative stress but also re-establishes immune homeostasis, thereby contributing to the preservation of cardiac tissue structure and function.
EPO Suppresses Cd Induced Ferroptotic and Apoptotic ActivationCadmium exposure markedly disrupted ferroptosis regulating proteins, as evidenced by a profound decline in SLC7A11 (3.1 ± 0.74 vs. 36.9 ± 3.7 in controls, p<0.0001) and GPX4 (9.7 ± 2.6 vs. 115.2 ± 10.1, p<0.05. This suppression of cystine transport and lipid peroxide detoxification indicates a strong ferroptotic drive in Cd treated myocardium.
Simultaneously, Cd provoked a robust apoptotic response. Bax increased sharply to 12.7 ± 1.2 compared with 0.80 ± 0.07 in controls (p<0.05), while caspase 3 rose to 72.4 ± 14.3 from 10.6 ± 1.5 (p<0.05). In contrast, the anti apoptotic mediator Bcl 2 fell dramatically to 0.57 ± 0.23 relative to 3.87 ± 0.83 in control rats (p<0.05).
Co administration of EPO (6000 IU/kg) substantially countered these molecular disturbances. EPO restored SLC7A11 to 20.6 ± 2.1 (p<0.05 vs. Cd) and elevated GPX4 to 71.0 ± 12.1 (p<0.05), indicating a strong reversal of ferroptotic signaling. Apoptotic markers were also markedly reduced: Bax decreased to 3.78 ± 0.55, and caspase 3 declined to 37.7 ± 5.1 (both p<0.05 vs. Cd). Meanwhile, Bcl 2 increased to 2.19 ± 0.38 (p<0.05), demonstrating reactivation of anti apoptotic defenses (Fig. 3A-E).
EPO Restores PI3K/AKT Signaling Suppressed by Cd ExposureCadmium markedly inhibited the PI3K/AKT survival pathway, as reflected by a sharp reduction in PI3K expression from 1.00 ± 0.00 in control rats to 0.22 ± 0.02 (p<0.05). A similar pattern was observed for AKT, which declined from 1.00 ± 0.00 to 0.12 ± 0.03 (p<0.05). This coordinated suppression indicates a strong inhibitory effect of Cd on upstream prosurvival signaling.
Co administration of EPO (6000 IU/kg) significantly counteracted this inhibition. PI3K levels increased to 0.55 ± 0.04 (p<0.05 vs. Cd), while AKT rose to 0.63 ± 0.11 (p<0.05 vs. Cd), demonstrating partial but meaningful reactivation of the pathway (Fig. 3F, G).
Reinstatement of PI3K/AKT signaling by EPO aligns with the previously described improvements in oxidative, inflammatory, and apoptotic markers. Since PI3K/AKT is known to enhance Nrf2 activation and suppress NF κB, its restoration provides a mechanistic explanation for the broad cytoprotective effects observed in EPO treated Cd exposed myocardium.
Discussion
Cadmium (Cd) remains a pervasive environmental contaminant due to its extensive use in industrial processes and incorporation into numerous consumer products. As a result, human exposure is common, particularly through cigarette smoke, contaminated food sources, and inhalation of polluted air in proximity to industrial facilities or hazardous waste sites.9 Epidemiological investigations consistently demonstrate that elevated Cd burden is associated with increased mortality from cardiovascular disorders.10 Experimental and clinical evidence further confirms that Cd accumulates within cardiac tissue, contributing directly to structural and functional myocardial injury in both humans and animal models.11,12
In this study, the cardioprotective potential of erythropoietin (EPO) against Cd induced myocardial injury in rats was evaluated. Co treatment with EPO preserved normal cardiac architecture and mitigated Cd triggered pathological alterations. This protection was primarily attributed to activation of the Nrf2 signaling pathway, which enhanced antioxidant enzyme expression and reduced oxidative stress markers, including ROS and MDA. EPO administration also attenuated inflammatory signaling by suppressing NF κB activation and its downstream cytokines. Furthermore, EPO maintained cardiomyocyte integrity by limiting both ferroptotic and apoptotic cell death pathways.
Evidence from the present study aligns with the observations of Alruhaimi et al.,13 demonstrating that cadmium exposure produces clear biochemical and morphological signs of cardiac injury.
Previous investigations have shown that cadmium (Cd) toxicity is largely driven by its ability to trigger extensive peroxidation of membrane polyunsaturated fatty acids, generating free radical species and amplifying ROS formation, ultimately weakening endogenous antioxidant defenses.14 These observations are consistent with our findings, where a single Cd dose markedly suppressed Nrf2 and (HO 1), reduced (SOD) and (CAT) activities, and simultaneously increased ROS and (MDA) levels. In contrast, co treatment with (EPO) preserved cardiac architecture and improved cardiac enzyme profiles. This aligns with the cardioprotective effects reported by Rezaee et al.15 in carbon monoxide–induced cardiac injury, and with Diab et al.,16 who demonstrated EPO mediated modulation of CK MB in myocardial infarction. Our results also parallel those of Liu et al.,17 who showed that EPO enhances Nrf2 signaling in a model of cirrhotic cardiomyopathy. Erythropoietin exerts potent antioxidant effects that extend beyond its classical hematopoietic role. Mechanistically, EPO activates the EPOR–JAK2 signaling axis, which subsequently stimulates downstream pathways such as PI3K/AKT and MAPK. Activation of PI3K/AKT is particularly important for redox regulation, as it promotes the nuclear translocation and transcriptional activity of Nrf2. Once activated, Nrf2 binds to antioxidant response elements (AREs) and enhances the expression of cytoprotective enzymes including HO 1, SOD, CAT, and glutathione related enzymes.
Reactive oxygen species (ROS) are known to activate several intracellular signaling cascades, including the TLR4/NF κB pathway, which drives the transcription of pro inflammatory mediators. This activation not only enhances cytokine production but also perpetuates oxidative stress and contributes to cell death.18 Our findings align with this mechanism, as Cd exposed animals exhibited a pronounced inflammatory response characterized by elevated cardiac levels of NF κB, IL 6, IL 1β, and TNF α compared with normal controls. These results are consistent with the observations of Alruhaimi et al.,13 who demonstrated that cadmium activates the TLR4/NF κB axis and upregulates inflammatory markers such as TNF α, IL 6, and COX 2. In contrast, animals receiving EPO alongside Cd showed a marked reduction in these inflammatory mediators, supporting the findings of Qin et al.,19 who reported that EPO mitigates sepsis related myocardial injury through suppression of NF κB signaling. Erythropoietin exerts strong anti inflammatory actions that complement its antioxidant properties.
Ferroptosis is defined by excessive iron accumulation and lipid peroxidation, processes that ultimately compromise membrane integrity and promote regulated cell death.20 Our findings demonstrate that Cd markedly suppresses the expression of GPX4 and SLC7A11, consistent with the observations of Xiong et al.,21 who reported Cd induced inhibition of these key ferroptosis regulatory proteins. Cd exposure also enhanced apoptotic signaling in cardiac tissue, corroborating the results of Refaie et al.,22 who identified a strong pro apoptotic influence of Cd in experimental cardiotoxicity. Importantly, co administration of EPO effectively reversed both ferroptotic and apoptotic alterations in cardiomyocytes. This protective action aligns with the findings of Kang et al.,23 who demonstrated that EPO suppresses neuronal ferroptosis in spinal cord injury, and with Rezaee et al.,15 who reported the anti apoptotic effects of EPO in carbon monoxide induced cardiac injury. Erythropoietin protects cardiomyocytes from ferroptosis and apoptosis through convergent antioxidant and survival pathways. By activating EPOR–JAK2–PI3K/AKT signaling, EPO restores GPX4 and SLC7A11 expression, enhances glutathione availability, and limits Fe²⁺ driven lipid peroxidation, thereby suppressing ferroptotic cell death. Simultaneously, EPO promotes anti apoptotic signaling by stabilizing mitochondrial membranes, increasing Bcl 2, reducing Bax, and preventing caspase activation.
The present findings demonstrate that cadmium exposure markedly suppresses the PI3K/AKT survival pathway, as reflected by the significant reduction in both PI3K and AKT expression, consistent with earlier observations by Liu et al..24 This inhibition is particularly detrimental because PI3K/AKT signaling is a central regulator of cell survival, redox homeostasis, and inflammatory responses. The substantial restoration of PI3K and AKT levels following EPO co administration indicates that EPO’s cardioprotective actions are mediated, at least in part, through reactivation of this pro survival axis. Notably, the reinstatement of PI3K/AKT signaling by EPO, as also reported by Tóthová, ,25 provides a mechanistic explanation for the observed improvements in oxidative stress, inflammation, and cell death. Given that PI3K/AKT serves as an upstream activator of Nrf2 and a suppressor of NF κB, its restoration clarifies how EPO simultaneously enhances antioxidant defenses while attenuating inflammatory mediators.
Limitations
Limitations include: single acute cadmium dose (not chronic human exposure), high short-term EPO dose (6000 IU/kg), no pathway inhibitor validation, lack of functional cardiac measures, and male-only subjects. Future work requires chronic models, functional testing, mechanistic probes, and both sexes.
Conclusion
In summary, environmental cadmium induces experimental cardiotoxicity via oxidative stress, inflammation, and ferroptosis/apoptosis. Erythropoietin confers cardioprotection by restoring PI3K/AKT/Nrf2 signaling and suppressing the NF-κB pathway, supporting its potential as a public health intervention for chronically exposed populations.
Declarations
Animal and Human Rights Statement
All procedures performed in this study were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.
Informed Consent
Not applicable.
Data Availability
The datasets used and/or analyzed during the current study are not publicly available due to patient privacy reasons but are available from the corresponding author on reasonable request.
Conflict of Interest
The authors declare that there is no conflict of interest.
Funding
None.
Author Contributions (CRediT Taxonomy)
Conceptualization: A.A.
Methodology: A.A.
Investigation: A.A.
Data Curation: A.A.
Formal Analysis: A.A.
Writing – Original Draft: A.A.
Writing – Review & Editing: A.A.
Supervision: A.A.
AI Usage Disclosure
The authors declare that no AI-assisted technologies were used.
Abbreviations
AKT: Protein kinase B
ANOVA: Analysis of variance
AST: Aspartate aminotransferase
CAT: Catalase
Cd: Cadmium
CdCl₂: Cadmium chloride
CK-MB: Creatine kinase MB
CMC: Carboxymethyl cellulose
ELISA: Enzyme-linked immunosorbent assay
EPO: Erythropoietin
GPX4: Glutathione peroxidase 4
GSH: Reduced glutathione
H&E: Hematoxylin and eosin
HO-1: Heme oxygenase-1
IL: Interleukin
i.p.: Intraperitoneal
LDH: Lactate dehydrogenase
MDA: Malondialdehyde
NF-κB: Nuclear factor kappa B
Nrf2: Nuclear factor erythroid 2-related factor 2
PI3K: Phosphoinositide 3-kinase
qRT-PCR: Quantitative real-time polymerase chain reaction
ROS: Reactive oxygen species
SLC7A11: Solute carrier family 7 member 11
SOD: Superoxide dismutase
TBARS: Thiobarbituric acid reactive substances
TNF-α: Tumor necrosis factor alpha
References
-
Friberg LT, Elinder GG, Kjellstrom T, et al. Cadmium and Health: A Toxicological and Epidemiological Appraisal: Volume 2: Effects and Response. CRC Press; 2019. doi:10.1201/9780429260599
-
Guo K, Ge J, Zhang C, et al. Cadmium-induced cardiac inflammation in chicken (Gallus gallus) via modulating cytochrome P450 systems and Nrf2-mediated antioxidant defense. Chemosphere. 2020;249:125858. doi:10.1016/j.chemosphere.2020.125858
-
Ansari MN, Ganaie MA, Rehman NU, et al. Protective role of roflumilast against cadmium-induced cardiotoxicity through inhibition of oxidative stress and NF-κB signaling in rats. Saudi Pharm J. 2019;27(5):673-681. doi:10.1016/j.jsps.2019.04.002
-
Ferlazzo N, Micali A, Marini HR, et al. A flavonoid-rich extract from bergamot juice, alone or in association with curcumin and resveratrol, shows protective effects in a murine model of cadmium-induced testicular injury. Pharmaceuticals (Basel). 2021;14(5):386. doi:10.3390/ph14050386
-
Pourtaji A, Jahani V, Sahebkar A, et al. Application of erythropoietin in chronic heart failure treatment. Mini Rev Med Chem. 2021;20(20):2080-2089. doi:10.2174/1389557520999200728155543
-
Santhanam AV, d'Uscio LV, Katusic ZS. Cardiovascular effects of erythropoietin: an update. Adv Pharmacol. 2010;60:257-285. doi:10.1016/b978-0-12-385061-4.00009-x
-
Saddam Z, Kamal Y, Waheed H. The potential hepatoprotective effect of erythropoietin against liver damage induced by doxorubicin through modulation of PI3K/AKT/GSK3β and activation of NRF2/HO-1 pathway. Int J Innov Res Sci Stud. 2025;8(1):223-238.
-
de Lima EC, de Moura CFG, Silva MJD, et al. Therapeutical properties of Mimosa caesalpiniifolia in rat liver intoxicated with cadmium. Environ Sci Pollut Res Int. 2020;27(10):10981-10989. doi:10.1007/s11356-019-07455-2
-
Yassin AS, Martonik JF. Urinary cadmium levels in the US working population, 1988-1994. J Occup Environ Hyg. 2004;1(5):324-333. doi:10.1080/15459620490445499
-
Nawrot TS, Van Hecke E, Thijs L, et al. Cadmium-related mortality and long-term secular trends in the cadmium body burden of an environmentally exposed population. Environ Health Perspect. 2008;116(12):1620-1628. doi:10.1289/ehp.11667
-
Egger AE, Grabmann G, Gollmann-Tepeköylü C, et al. Chemical imaging and assessment of cadmium distribution in the human body. Metallomics. 2019;11(12):2010-2019. doi:10.1039/c9mt00178f
-
Young JL, Yan X, Xu J, et al. Cadmium and high-fat diet disrupt renal, cardiac, and hepatic essential metals. Sci Rep. 2019;9(1):14675. doi:10.1038/s41598-019-50771-3
-
Alruhaimi RS, Hassanein EHM, Bin-Jumah MN, et al. Cadmium cardiotoxicity is associated with oxidative stress and upregulated TLR-4/NF-κB pathway in rats; protective role of agomelatine. Food Chem Toxicol. 2023;180:114055. doi:10.1016/j.fct.2023.114055
-
Casalino E, Calzaretti G, Sblano C, et al. Molecular inhibitory mechanisms of antioxidant enzymes in rat liver and kidney by cadmium. Toxicology. 2002;179(1-2):37-50. doi:10.1016/s0300-483x(02)00245-7
-
Rezaee MA, Moallem SA, Mohammadpour AH, et al. Histopathological study of erythropoietin protective effect on carbon monoxide-induced cardiotoxicity in rat. Iran J Basic Med Sci. 2017;20(11):1189-1193.
-
Diab AA, Abulfadle KA, Mohammed NA, et al. Cardiac and renal protective role of erythropoietin in a rat model of acute myocardial infarction. Zagazig Univ Med J. 2022;28(1):35-44.
-
Liu L, Liu H, Nam SW, et al. Protective effects of erythropoietin on cirrhotic cardiomyopathy in rats. Dig Liver Dis. 2012;44(12):1012-1017. doi:10.1016/j.dld.2012.06.020
-
Asehnoune K, Strassheim D, Mitra S, et al. Involvement of reactive oxygen species in Toll-like receptor 4-dependent activation of NF-κB. J Immunol. 2004;172(4):2522-2529. doi:10.4049/jimmunol.172.4.2522
-
Qin YJ, Zhang XL, Yu YQ, et al. Cardioprotective effect of erythropoietin on sepsis-induced myocardial injury in rats. World J Emerg Med. 2013;4(3):215-222. doi:10.5847/wjem.j.issn.1920-8642.2013.03.011
-
Stockwell BR, Friedmann Angeli JP, Bayir H, et al. Ferroptosis: a regulated cell death nexus linking metabolism, redox biology, and disease. Cell. 2017;171(2):273-285. doi:10.1016/j.cell.2017.09.021
-
Xiong L, Zhou B, Young JL, et al. Exposure to low-dose cadmium induces testicular ferroptosis. Ecotoxicol Environ Saf. 2022;234:113373. doi:10.1016/j.ecoenv.2022.113373
-
Refaie MMM, El-Hussieny M, Bayoumi AMA, et al. Mechanisms mediating the cardioprotective effect of carvedilol in cadmium-induced cardiotoxicity: role of eNOS and HO-1/Nrf2 pathway. Environ Toxicol Pharmacol. 2019;70:103198. doi:10.1016/j.etap.2019.103198
-
Kang Y, Zhu R, Li S, et al. Erythropoietin inhibits ferroptosis and ameliorates neurological function after spinal cord injury. Neural Regen Res. 2023;18(4):881-888. doi:10.4103/1673-5374.353496
-
Liu L, Zhao Q, Huang J, et al. Cadmium-induced hepatotoxicity in mice: prophylactic supplementation of quercetin exerts hepatoprotective effect by modulating PI3K/Akt/NF-κB signaling pathway. Physiol Res. 2024;73(5):703-716. doi:10.33549/physiolres.935252
-
Tóthová Z, Šemeláková M, Solárová Z, et al. The role of PI3K/AKT and MAPK signaling pathways in erythropoietin signalization. Int J Mol Sci. 2021;22(14):7682. doi:10.3390/ijms22147682
Additional Information
Publisher’s Note
Bayrakol MP remains neutral with regard to jurisdictional and institutional claims.
Rights and Permissions
About This Article
- Received:
- May 21, 2026
- Published Online:
- June 20, 2026
