Diacerein attenuates cisplatin-induced cerebellar neurotoxicity in rats: modulation of PI3K/AKT signaling and inhibition of NLRP3-mediated pyroptosis

Abstract

AimThis study investigated Diacerein's capacity to protect the cerebellum from cisplatin-driven neurotoxicity characterized by oxidative stress, inflammation, and apoptosis and clarified the associated molecular pathways.MethodsForty adult male Wistar rats were assigned to four groups: control, Diacerein (100 mg/kg), cisplatin (10 mg/kg), and cisplatin plus Diacerein. After seven days of treatment, cerebellar tissues were assessed for oxidative, inflammatory, apoptotic, and pyroptotic alterations using biochemical assays, ELISA, and qRT PCR.ResultsCisplatin exposure caused profound cerebellar degeneration, evidenced by heightened lipid peroxidation, depletion of endogenous antioxidant defenses, and marked suppression of the PI3K/AKT survival pathway. These disturbances were accompanied by robust activation of the NF κB/NLRP3 inflammasome axis, resulting in elevated pro inflammatory cytokines (TNF α, IL 6, IL 1β) and increased pyroptotic mediators (caspase 1, IL 18, GSDMD). Apoptotic imbalance was also apparent, with upregulation of Bax and caspase 3 and reduced Bcl 2 expression. Histopathological examination corroborated these biochemical disruptions. Co administration of Diacerein significantly mitigated cisplatin induced cerebellar toxicity by restoring redox homeostasis, reactivating PI3K/AKT signaling, and suppressing NF κB driven inflammatory and pyroptotic cascades. Diacerein also normalized apoptotic markers and preserved cerebellar architecture.ConclusionCollectively, these findings indicate that Diacerein affords substantial neuroprotection against cisplatin induced cerebellar degeneration through coordinated modulation of oxidative stress, inflammation, and programmed cell death pathways, highlighting its promise as an adjuvant strategy to reduce chemotherapy associated neurotoxicity.

Keywords

Introduction

Cisplatin (CS) remains a first-line chemotherapeutic drug for various cancers, including those of the esophagus, testes, cervix, bladder, ovaries, head, and neck.¹ Nevertheless, its therapeutic benefit is restricted by considerable harm to non-cancerous tissues.² Common neurological complications include impaired cognition, shortened attention span, and loss of executive function.³ Healthy cells tend to take up more cisplatin than malignant cells, increasing their vulnerability to injury.⁴ Severe peripheral neuropathy often necessitates lowering the dose or stopping treatment early.⁵ Additional reported adverse effects involve hearing loss, kidney damage, cardiovascular issues, gonadal dysfunction, liver injury, and toxicity to both central and peripheral nerves.⁶
Oxidative stress is a major contributor to cisplatin-induced tissue damage. Physiologically, cells manage reactive oxygen species (ROS) through antioxidant defenses. Cisplatin disrupts this equilibrium by attacking mitochondrial sulfhydryl groups, interfering with calcium uptake, collapsing the mitochondrial membrane potential,⁷ lowering glutathione (GSH) levels, and weakening antioxidant capacity.⁸ These events cause widespread harm to proteins, lipids, and DNA. In neural tissue, excessive ROS generation, DNA injury, inflammatory responses, mitochondrial failure, and regulated cell death are key drivers of cisplatin-evoked neurotoxicity.⁹ Despite previous research, the exact apoptotic pathways triggered by cisplatin in the brain remain incompletely understood.
Diacerein (DIA), an anthraquinone compound originally developed for osteoarthritis, blocks IL-1β converting enzyme and antagonizes IL-1β receptor binding.¹⁰ Evidence from animal models and human trials indicates that DIA offers substantial protection against inflammatory damage ¹¹ by reducing nitric oxide, TNF-α, and IL-1β, as well as downregulating the IL-1β receptor.¹² DIA also suppresses TLR4/NF-κB signaling, thereby decreasing inflammatory mediator production.¹³ Based on these properties, this study examined whether DIA could protect against cisplatin-induced cerebellar injury in male rats, with emphasis on the PI3K/AKT signaling pathway.

Materials and Methods

Experimental Animals Adult male Wistar albino rats (n=40, 160–200 g) were kept in polypropylene cages under controlled conditions (23 ± 2°C, 45–50% humidity, natural light/dark cycle) with unlimited food and water throughout the study. Experimental Design For this study, forty adult male rats were randomly assigned to four groups (n=10 per group) using a computer-generated random number table. The control group received 1 ml of oral saline daily for seven days. The DIA group was given diacerein orally at 100 mg/kg body weight each day for seven consecutive days; this dose was chosen based on our preliminary experiments and prior reports.¹¹ The CS group received a single intraperitoneal injection of cisplatin (10 mg/kg) on experiment day four,¹⁴ without any diacerein treatment. The CS+DIA group received the same cisplatin injection (10 mg/kg i.p. on day four) plus oral diacerein (100 mg/kg/day) for the full seven days. Sample size (n=10 per group) was determined based on a power analysis with 80% power and α = 0.05, calculated using G*Power software. About 24 hours after the last treatment, final body weights were recorded. Rats were then deeply anesthetized with an intraperitoneal ketamine/xylazine mixture and euthanized by decapitation. Brains were quickly and carefully removed. Small pieces of cerebellar tissue were immediately cut out, frozen in liquid nitrogen, and kept at -80°C for later qPCR analysis. The remaining cerebellar tissue was rinsed with cold phosphate-buffered saline (PBS, pH 7.4), then homogenized in fresh cold PBS. The homogenate was spun at 3000 × g for 10 minutes at 4°C to pellet debris. The resulting supernatant was collected, aliquoted, and stored at -20°C for biochemical measurements. Additional cerebellar samples were placed in 10% neutral buffered formalin for histological examination. Biochemical Assay Thawed cerebellar samples were weighed and homogenized (10% w/v) in cold phosphate buffer at 12,000 rpm for 2 minutes. MDA was measured at 532 nm. GSH was read at 410 nm. SOD activity was assessed at 560 nm. CAT activity was tracked by H₂O₂ degradation at 240 nm over one minute. Protein was quantified via Lowry method for normalization. Histological Analysis of Cerebellar Tissue Cerebellar samples were fixed for 6–8 hours in 4% paraformaldehyde (0.1 M phosphate buffer, pH 7.4), then dehydrated in graded ethanol, cleared with xylene, and embedded in paraffin. Sections (4 μm) were cut, deparaffinized, rehydrated, stained with H&E, and examined by light microscopy. ELISA Assay The concentrations of inflammatory, apoptotic, and signaling biomarkers were quantified using commercially available ELISA kits following the manufacturers' instructions. The following kits and detection ranges were used in this study: p-AKT (MyBioSource, San Diego, CA, USA; Cat# MBS8821006, 15.63–1000 pg/mL), PI3K (MyBioSource, San Diego, CA, USA; Cat# MBS702819, 15.6–1000 pg/mL), caspase-1 (Novus Biologicals, Centennial, CO, USA; Cat# NBP2-75015, 62.50–4000 pg/mL), GSDMD (LifeSpan BioSciences, Seattle, WA, USA; Cat# LS-F39621-1, 0.156–10 ng/mL), IL-1β (Thermo Fisher Scientific, Waltham, MA, USA; Cat# BMS630, 31.3–2000 pg/mL), IL-6 (Thermo Fisher Scientific, Waltham, MA, USA; Cat# ERA31RB, 30–10,000 pg/mL), TNF-α (ELK Biotechnology, Wuhan, China; Cat# ELK1396, 15.63–1000 pg/mL), NF-κB (MyBioSource, San Diego, CA, USA; Cat# MBS453975, 0.312–20 ng/mL), IL-18 (Elabscience, Houston, TX, USA; Cat# E-EL-R0567, 15.63–1000 pg/mL), Bax (ELK Biotechnology, Wuhan, China; Cat# ELK5698, 12.5–800 pg/mL), caspase-3 (BioAssay Systems, Hayward, CA, USA; Cat# E1648Ra, 0.05–10 ng/mL), and Bcl-2 (Novus Biologicals, Centennial, CO, USA; Cat# NBP2-69947, 0.16–10 ng/mL). Quantitative Real-Time PCR (qRT-PCR) Analysis Total cerebellar RNA was extracted with TRIzol per the manufacturer's protocol. RNA purity and concentration were checked. One microgram of RNA was reverse-transcribed to cDNA using a commercial kit. qRT-PCR was run on a CFX96 system with SYBR Green mix. Cycling conditions: 95°C for 15 minutes, then 40 cycles of 95°C for 30 seconds, 60°C for 60 seconds, and 72°C for 60 seconds. NLRP3 primers (forward: TGCATGCCGTATCTGGTTGT, reverse: ACCTCTTGCGAGGGTCTTTG) and GAPDH primers (forward: AACTCCCATTCCTCCACCTT, reverse: GAGGGCCTCTCTCTTGCTCT) were used. Gene expression was calculated by the 2⁻ΔΔCT method and normalized to GAPDH. Ethical Approval The study was approved by the Ethics Committee of Umm Al-Qura University, Makkah, Saudi Arabia (Date: 05.02.2026, Decision No: HAPO-02-K-012-2026-05-3445). Statistical Analysis All data were first tested for normality using the Shapiro–Wilk test. Data were analyzed by one-way and two-way ANOVA, followed by Tukey's post-hoc test for group comparisons. GraphPad Prism 8.02 (GraphPad Software, San Diego, CA, USA) was used for all analyses. Results are expressed as mean ± SD. Statistical significance was set at P < .05. Reporting Guidelines The study was designed, conducted, and reported in accordance with the ARRIVE 2.0 guidelines.

Results

Protective Effect of Diacerein on Cerebellar Histology Histological examination of cerebellar sections from the control group and the diacerein-only negative control group revealed normal grey matter histology, with well-defined molecular, Purkinje, and granular layers. In contrast, sections from the CS-treated group showed marked degeneration of the Purkinje layer, characterized by neuronal damage and loss. However, the group co-treated with diacerein, and CS exhibited significant improvement in Purkinje neuronal histology, with only a few damaged neurons remaining (Figure 1A–D). These findings indicate a protective effect of diacerein on cerebellar histology in the CS-induced cerebellar toxicity. Antioxidant Effect of DIA Against CS-induced Cerebellar Oxidation As demonstrated in Figure 2A–D, a single intraperitoneal dose of CS induced severe oxidative stress in cerebellar tissue, evidenced by a marked elevation in MDA levels accompanied by a significant (P < .05) reduction in cerebellar SOD, GSH, and CAT activities compared with normal rats. In Group IV, which received 100 mg/kg DIA along with a single dose of CS, a clear attenuation of CS induced cerebellar oxidative stress was observed. This was reflected by the reversal of the previously altered oxidant and antioxidant parameters. Overall, DIA exerted a strong antioxidant effect, ameliorating the pathological changes associated with CS induced cerebellar oxidative degeneration in this rat model. Impact of CS and DIA on the PI3K/AKT Pathway ELISA quantification of cerebellar PI3K and p AKT levels (Figure 2E, F) revealed a marked reduction in Group III (CS treated rats) compared with the control group. In contrast, the combined treatment group that received DIA alongside CS showed significantly elevated levels of both PI3K and p AKT in cerebellar homogenates relative to the CS group. These findings indicate that DIA exerts a positive modulatory effect on the PI3K/AKT pathway, counteracting the inhibitory impact induced by CS. Effects of DIA and CS on the NF κB/NLRP3 Inflammatory and Pyroptotic Pathway Figure 2G–J demonstrates the pronounced inflammatory response induced by CS in cerebellar tissue. CS exposure markedly increased cerebellar NF κB levels, indicating activation of this key inflammatory transcription factor. Consequently, ELISA measurements showed significant elevations in pro inflammatory cytokines, including TNF α, IL 6, and IL 1β. Activation of NF κB further triggered pyroptotic signaling through stimulation of the NLRP3 inflammasome, which in turn activated caspase 1. Caspase 1 activation enhanced the maturation and secretion of IL 1β and promoted increased production of the inflammatory cytokine IL 18. In addition, the upregulated pathway activated GSDMD, leading to pore formation in the cellular membrane and subsequent membrane rupture—hallmark features of pyroptotic cell death (Fig. 3A-D). All these inflammatory and pyroptotic markers were markedly elevated in the CS treated group compared with normal animals. Interestingly, co treatment with DIA (CS + DIA group) resulted in a significant reduction in all inflammatory parameters and key components of the pyroptotic pathway relative to the CS group. Collectively, these findings confirm the potent anti inflammatory and anti pyroptotic effects of DIA, highlighting its central mechanistic role in mitigating CS induced cerebellar degeneration in this animal model. Amelioration of CS Induced Cerebellar Apoptosis by DIA Administration Figure 3E-G illustrates the cerebellar apoptotic profile, showing significant elevations in the pro apoptotic markers caspase 3 and Bax, accompanied by a marked reduction in the anti apoptotic protein Bcl 2 in the CS treated group compared with normal rats. In contrast, co administration of CS with oral DIA produced a clear protective effect, characterized by a notable increase in Bcl 2 levels alongside a significant reduction in caspase 3 and Bax protein expression. These findings strongly support the anti apoptotic action of DIA in counteracting CS induced cerebellar apoptotic changes, further corroborated by the accompanying histological observations.

Discussion

Cisplatin's cancer-killing power is limited by toxicity to healthy tissues via oxidative stress and cell death, but our findings show that diacerein co-administration protects cerebellar tissue from this damage.
Oxidative stress plays a central role in CS-related injury to both nerve and non-nerve tissues.¹⁵ Our data show that a single CS injection on day four raised MDA levels and lowered both enzyme-based and non-enzyme antioxidants in the cerebellum compared to healthy controls. Treating with diacerein alongside CS significantly reduced this oxidative burden. Similar protective effects were reported by Abd Elrazik & Abd El Salam,¹⁶ who found that diacerein lowered MDA and raised GSH in a model of liver-related brain damage. Likewise, El-Sherbiny et al,¹⁷ showed that diacerein reduced MDA while increasing SOD, CAT, and GSH in prostate tissue.
Earlier work has shown that cisplatin exposure provokes an inflammatory reaction in the mouse cerebellar cortex.¹⁸ In line with this, we saw marked rises in pro-inflammatory markers in CS-treated animals. Such cytokines are key players in neuroinflammation.¹⁹ In cultured cerebellar cells, these inflammatory signals can cause loss of myelin and damage to nerve fibers. Furthermore, neuroinflammation and the resulting cytokine release have been linked to thinking and memory problems, including those seen in Alzheimer's disease.
Our results agree with these earlier reports. We found that CS greatly increased NF-κB and several pro-inflammatory cytokines in the cerebellum. Giving diacerein orally reversed this neuroinflammatory state, lowering NF-κB, TNF-α, IL-6, and IL-1β. This matches previous studies showing that diacerein blocks NF-κB activation in models of urethritis.²⁰
The NLRP3 inflammasome is an important part of the body's innate immune defense and has been linked to disease progression, especially in kidney and brain tissues.²¹ Our work showed strong activation of inflammasome components, including NLRP3, IL-1β, caspase-1, IL-18, and GSDMD, pointing to pyroptosis in cerebellar neurons. When CS was given together with diacerein, this pyroptotic pathway was suppressed through inhibition of inflammasome formation, in agreement with earlier findings.²²
CS caused clear structural damage in the cerebellum, including loss of Purkinje cells. It is believed that CS attaches to acetylcholine receptors on these cells, setting off cell death pathways. Similar observations were made by Mohiuddin & Kasahara,²³ who found that activating cisplatin receptors led to programmed cell death in brain progenitor cells. Our data confirm that CS raised pro-apoptotic markers (Bax, caspase-3) and lowered the protective marker Bcl-2 in the cerebellum. Giving diacerein along with CS reversed these changes and preserved tissue structure, consistent with the work of Rasheed et al.,²⁴ who reported that diacerein helps maintain normal cerebellar architecture.

Limitations

This study has limitations (short duration, single dose, male-only, no pathway inhibitors, cerebellar focus only). Nevertheless, diacerein consistently protected against cisplatin-induced cerebellar injury across multiple molecular pathways, providing a strong foundation for future animal studies.

Conclusion

In summary, diacerein protects against cisplatin-induced cerebellar damage by lowering oxidative stress, reactivating PI3K/AKT, suppressing NF-κB/NLRP3-driven pyroptosis, and restoring apoptotic balance (increased Bcl-2, decreased Bax and caspase-3).

Declarations

Abbreviations

References

1. Fahmy MI, Khalaf SS, Yassen NN, et al. Nicorandil attenuates cisplatin-induced acute kidney injury in rats via activation of PI3K/AKT/mTOR signaling cascade and inhibition of autophagy. Int Immunopharmacol. 2024;127:111457. doi:10.1016/j.intimp.2023.111457
   Article · PubMed · Google Scholar
2. Adelakun SA, Akintunde OW, Ogunlade B, et al. Histochemical and histomorphological evidence of the modulating role of 1-isothiocyanate-4-methyl sulfonyl butane on cisplatin-induced testicular-pituitary axis degeneration and cholesterol homeostasis in male Sprague-Dawley rats. Morphologie. 2023;107(356):80-98. doi:10.1016/j.morpho.2022.05.002
   Article · PubMed · Google Scholar
3. Afsar T, Razak S, Almajwal A. Reversal of cisplatin-triggered neurotoxicity by Acacia hydaspica ethyl acetate fraction via regulation of brain acetylcholinesterase activity, DNA damage, and proinflammatory cytokines in a rodent model. BMC Complement Med Ther. 2022;22(1):179. doi:10.1186/s12906-022-03657-3
   Article · PubMed · Google Scholar
4. Gandin V, Hoeschele JD, Margiotta N. Special issue “Cisplatin in cancer therapy: molecular mechanisms of action 3.0.” Int J Mol Sci. 2023;24(9):7917. doi:10.3390/ijms24097917
   Article · PubMed · Google Scholar
5. Országhová Z, Mego M, Chovanec M. Long-term cognitive dysfunction in cancer survivors. Front Mol Biosci. 2021;8:770413. doi:10.3389/fmolb.2021.770413
   Article · PubMed · Google Scholar
6. Fu X, Wan P, Li P, et al. Mechanism and prevention of ototoxicity induced by aminoglycosides. Front Cell Neurosci. 2021;15:692762. doi:10.3389/fncel.2021.692762
   Article · PubMed · Google Scholar
7. Saad SY, Najjar TA, Alashari M. Role of nonselective adenosine receptor blockade and phosphodiesterase inhibition in cisplatin-induced nephrogonadal toxicity in rats. Clin Exp Pharmacol Physiol. 2004;31(12):862-867. doi:10.1111/j.1440-1681.2004.04127.x
   Article · PubMed · Google Scholar
8. Kart A, Cigremis Y, Karaman M, et al. Caffeic acid phenethyl ester (CAPE) ameliorates cisplatin-induced hepatotoxicity in rabbits. Exp Toxicol Pathol. 2010;62:45-52. doi:10.1016/j.etp.2009.02.066
   Article · PubMed · Google Scholar
9. Gorgun MF, Zhuo M, Englander EW. Cisplatin toxicity in dorsal root ganglion neurons is relieved by meclizine via diminution of mitochondrial compromise and improved clearance of DNA damage. Mol Neurobiol. 2017;54(10):7883-7895. doi:10.1007/s12035-016-0273-9
   Article · PubMed · Google Scholar
10. Abdel-Gaber SA, Mohammed RK, Refaie MMM. Mechanism mediating the protective effect of diacerein in ischemia-reperfusion-induced testicular injury in rats. Life Sci. 2018;209:57-62. doi:10.1016/j.lfs.2018.07.060
    Article · PubMed · Google Scholar
11. da Silva KLC, Camacho AP, Mittestainer FC, et al. Atorvastatin and diacerein reduce insulin resistance and increase disease tolerance in rats with sepsis. J Inflamm (Lond). 2018;15:8. doi:10.1186/s12950-018-0184-9
    Article · PubMed · Google Scholar
12. Fouad AA, Abdel-Aziz AM, Hamouda AAH. Diacerein downregulates NLRP3/caspase-1/IL-1β and IL-6/STAT3 pathways of inflammation and apoptosis in a rat model of cadmium testicular toxicity. Biol Trace Elem Res. 2020;195(2):499-505. doi:10.1007/s12011-019-01865-6
    Article · PubMed · Google Scholar
13. de Oliveira PG, Termini L, Durigon EL, et al. Diacerein: a potential multitarget therapeutic drug for COVID-19. Med Hypotheses. 2020;144:109920. doi:10.1016/j.mehy.2020.109920
    Article · PubMed · Google Scholar
14. Capasso G, Giordano DR, de Tommaso G, et al. Parathyroidectomy has a beneficial effect on experimental cisplatin nephrotoxicity. Clin Nephrol. 1990;33(4):184-191.
    PubMed · Google Scholar
15. Mirzaei S, Hushmandi K, Zabolian A, et al. Elucidating the role of reactive oxygen species in cisplatin chemotherapy: a focus on molecular pathways and possible therapeutic strategies. Molecules. 2021;26(8):2382. doi:10.3390/molecules26082382
    Article · PubMed · Google Scholar
16. Abd Elrazik NA, Abd El Salam ASG. Diacerein ameliorates thioacetamide-induced hepatic encephalopathy in rats via modulation of the TLR4/AQP4/MMP-9 axis. Metab Brain Dis. 2025;40(1):10.
    PubMed · Google Scholar
17. El-Sherbiny M, El-Shafey M, El-Din El-Agawy MS, et al. Diacerein ameliorates testosterone-induced benign prostatic hyperplasia in rats: effect on oxidative stress, inflammation, and apoptosis. Int Immunopharmacol. 2021;100:108082. doi:10.1016/j.intimp.2021.108082
    Article · PubMed · Google Scholar
18. Attia A, Matta C, ElMazoudy R, et al. Cisplatin-induced neurotoxicity in the cerebellar cortex of male mice involves oxidative stress and histopathology. J Basic Appl Zool. 2021;82(1):23. doi:10.1186/s41936-021-00220-3
    Article · PubMed · Google Scholar
19. Vezzani A, Balosso S, Ravizza T. Neuroinflammatory pathways as treatment targets and biomarkers in epilepsy. Nat Rev Neurol. 2019;15(8):459-472. doi:10.1038/s41582-019-0217-x
    Article · PubMed · Google Scholar
20. Cheng G, Li Z, Zhang L, et al. Diacerein ameliorates acute urarthritis in rats through the Nrf2/HO-1 and NF-κB pathways. Inflammopharmacology. 2026;34(1):463-471. doi:10.1007/s10787-025-02059-4
    Article · PubMed · Google Scholar
21. Li S, Lin Q, Shao X, et al. NLRP3 inflammasome inhibition attenuates cisplatin-induced renal fibrosis by decreasing oxidative stress and inflammation. Exp Cell Res. 2019;383(1):111488. doi:10.1016/j.yexcr.2019.07.001
    Article · PubMed · Google Scholar
22. Taha M, Mahmoud Ibrahim M, Elazab ST, et al. Diacerein mitigates renal ischemia/reperfusion injury via inhibition of renal inflammation, dendritic cell maturation, and apoptosis: the role of the TLR4/NF-κB/NLRP3/IL-1β signaling pathway. Int J Morphol. 2023;41(2). doi:10.4067/s0717-95022023000200625
    Article · PubMed · Google Scholar
23. Mohiuddin M, Kasahara K. Cisplatin activates growth-inhibitory signaling pathways by enhancing the production of reactive oxygen species in non-small cell lung cancer carrying an EGFR exon 19 deletion. Cancer Genomics Proteomics. 2021;18(3 suppl):471-486. doi:10.21873/cgp.20273
    Article · PubMed · Google Scholar
24. Rasheed RA, Sadek AS, Khattab RT, et al. Diacerein provokes apoptosis, improves redox balance, and downregulates PCNA and TNF-α in a rat model of testosterone-induced benign prostatic hyperplasia: a new noninvasive approach. PLoS One. 2023;18(11). doi:10.1371/journal.pone.0293682
    Article · PubMed · Google Scholar

Additional Information

Publisher’s Note
Bayrakol MP remains neutral with regard to jurisdictional and institutional claims.

Rights and Permissions